Skip to Content
Price List Default - EUR
  1. All Products
  2. Monkeypox virus dsDNA control (92 bp) - 200 nmol (HPLC Purified)
Monkeypox virus dsDNA control (92 bp) - 200 nmol (HPLC Purified)

Monkeypox virus dsDNA control (92 bp) - 200 nmol (HPLC Purified)

https://www.gentaur.be/web/image/product.template/22237/image_1920?unique=d621c77
(0 review)

Sense (5'-3') Sequence:

$ 0.00 0.0 USD $ 0.00

    This combination does not exist.

    Contact Us For Price                                                 

    Terms and Conditions
    30-day money-back guarantee
    Shipping: 2-3 Business Days of Stock Products

    Share

    Sense (5'-3') Sequence:
    TGGAAAGTGTAAAGACAACGAATACAGAAGCCGTAATCTATGTTGTCTATCGTGTCCTCCGGGAACTTACGCTTCCAGATTATGTGATAGCA