Hypothetical protein BG908_05820 201bp in pUC vector - 100ug plasmid + 200ul glycerol

(0 review)

377.40 377.40000000000003 USD 377.40

370.00 €

Not Available For Sale

    This combination does not exist.

    Terms and Conditions
    30-day money-back guarantee
    Shipping: 2-3 Business Days of Stock Products

    DNA sequence: 

    RC46GOI: atgagaaattctacttataaacaaaacaaaatttttattttagcctatgttatatttggattgttcatgggtctattttttgacttattgttatcaactcacatatacacattaagtcttttaagtatattttttggcttttttatactaggagtaatctttaagattatcctttcatgccaaaataaaaaacatatttag

    Protein sequence: