pGEX-4T-3 Plasmid - 2 ug

https://www.gentaur.com.de/web/image/product.template/7635/image_1920?unique=3213de2
(0 review)

Terms and Conditions
30-day money-back guarantee
Shipping: 2-3 Business Days of Stock Products

pGEX-4T-3 Plasmid Information


Alias: pgex4t3; pgex4t-3


TAC: promoter


Replicon: pBR322


Plasmid classification: Escherichia coli vector; pGEX series expression plasmid


Plasmid size: 4968 BP


Plasmid Tags: n-gst, n-thrombin


Prokaryotic resistance: amp


Clone strain: dh5a


Culture conditions: 37 degrees


Expression host: E.coli BL21 (DE3)


Culture conditions: 37 ℃, aerobic, lb


Induction method: IPTG or lactose and its analogues


5 'sequencing primer: pgex5: gggctggcaagccacgttgtggtg


3 'sequencing primer: pgex3: ccggaggtgcatgtcagagg


Note: GST affinity column can be used to purify recombinant protein


Plasmid host: Escherichia coli


Purpose of plasmid: protein expression


Fragment type: ORF


Fragment species: empty bodies


Prokaryotic resistance: amp




pGEX-4T-3 Plasmid Description


pGEX-4T-3 plasmid is a 4968 bp E.coli Expression Vector, which can be connected to the target gene through the enzyme cutting site at MCS, and tac promoter starts GST promoting labeling and target gene fusion expression.