PET28A- SUMO plasmid - 2 ug

https://www.gentaur.be/web/image/product.template/6829/image_1920?unique=3213de2
(0 review)

Terms and Conditions
30-day money-back guarantee
Shipping: 2-3 Business Days of Stock Products

Bacterial Resistance: Kanamycin

Growth Strain: DH5α

Expression: Bacterial

Use: pET Plasmid

Promoter: T7/lac

Replicator: ColE1, ori, F1, ori

Terminator: T7 Terminator

Plasmid classification: Escherichia coli vector, PET series of expressed plasmids

Plasmid size: 5633bp

Plasmid labels: N-6 * His, N-Thrombin, N-SUMO, C-6 * His

Prokaryotic resistance: kanamycin Kan

Clone strain: DH5 alpha

Culture conditions: 37 ℃, aerobic, LB

Expression host: BL21 (DE3)

Culture conditions: 37 ℃, aerobic, LB

Induction: IPTG or lactose and its analogues


Primers for 5'sequencing: T7: TAATACGACTCACTATAGGG

Primers for 3'sequencing: T7-ter: TGCTAGTTATTGCTCAGCGG