pBT3- N palsmid - 2ug

https://www.gentaur.be/web/image/product.template/87/image_1920?unique=f02cd15
(0 review)

307.02 307.02 USD 307.02

301.00 €

Not Available For Sale

    This combination does not exist.

    Terms and Conditions
    30-day money-back guarantee
    Shipping: 2-3 Business Days of Stock Products

    pBT3-N

    Catalog No. PVT11262
    Packing 2ug

     

    pBT3-N Information

    Promoter: CYC1

    Replicator: pBS

    Culture temperature: 37℃

    Plasmid host: Yeast

    Uses: hybridization; Membrane protein hybridization

    Prokaryotic resistance: Kan

    Filter Tags: LEU2

     

    pBT3-N Description
    pBT3-N is a yeast Hybrid plasmid.

     

    pBT3-N sequence 

    CAGAACCGTGGCATGGTTCGTACAAACCAAATGCGGTGTTCTTGTCTGGCAAAGAGGCCAAGGACGCAGATGGCAACAAACCCAAGGAACCTGGGATAACGGAGGCTTCATCGGAGATGATATCACCAAACATGTTGCTGGTGATTATAATACCATTTAGGTGGGTTGGGTTCTTAACTAGGATCATGGCGGCAGAATCAATCAATTGATGTTGAACCTTCAATGTAGGGAATTCGTTCTTGATGGTTTCCTCCACAGTTTTTCTCCATAATCTTGAAGAGGCCAAAACATTAGCTTTATCCAAGGACCAAATAGGCAATGGTGGCTCATGTTGTAGGGCCATGAAAGCGGCCATTCTTGTGATTCTTTGCACTTCTGGAACGGTGTATTGTTCACTATCCCAAGCGACACCATCACCATCGTCTTCCTTTCTCTTACCAAAGTAAATACCTCCCACTAATTCTCTGACAACAACGAAGTCAGTACCTTTAGCAAATTGTGGCTTGATTGGAGATAAGTCTAAAAGAGAGTCGGATGCAAAGTTACATGGTCTTAAGTTGGCGTACAATTGAAGTTCTTTACGGATTTTTAGTAAACCTTGTTCAGGTCTAACACTACCGGTACCCCATTTAGGACCACCCACAGCACCTAACAAAACGGCATCAGCCTTCTTGGAGGCTTCCAGCGCCTCATCTGGAAGTGGAACACCTGTAGCATCGATAGCAGCACCACCAATTAAATGATTTTCGAAATCGAACTTGACATTGGAACGAACATCAGAAATAGCTTTAAGAACCTTAATGGCTTCGGCTGTGATTTCTTGACCAACGTGGTCACCTGGCAAAACGACGATCTTCTTAGGGGCAGACATTAGAATGGTATATCCTTGAAATATATATATATATATTGCTGAAATGTAAAAGGTAAGAAAAGTTAGAAAGTAAGACGATTGCTAACCACCTATTGGAAAAAACAATAGGTCCTTAAATAATATTGTCAACTTCAAGTATTGTGATGCAAGCATTTAGTCATGAACGCTTCTCTATTCTATATGAAAAGCCGGTTCCGGCGCTCTCACCTTTCCTTTTTCTCCCAATTTTTCAGTTGAAAAAGGTATATGCGTCAGGCGACCTCTGAAATTAACAAAAAATTTCCAGTCATCGAATTTGATTCTGTGCGATAGCGCCCCTGTGTGTTCTCGTTATGTTGAGGAAAAAAATAATGGTTGCTAAGAGATTCGAACTCTTGCATCTTACGATACCTGAGTATTCCCACAGTTAACTGCGGTCAAGATATTTCTTGAATCAGGCGCCTTAGACCGCTCGGCCAAACAACCAATTACTTGTTGAGAAATAGAGTATAATTATCCTATAAATATAACGTTTTTGAACACACATGAACAAGGAAGTACAGGACAATTGATTTTGAAGAGAATGTGGATTTTGATGTAATTGTTGGGATTCCATTTTTAATAAGGCAATAATATTAGGTATGTAGATATACTAGAAGTTCTCCTCGACCGGTCGATATGCGGTGTGAAATACCGCACAGATGCGTAAGGAGAAAATACCGCATCAGGAAATTGTAAGCGTTAATATTTTGTTAAAATTCGCGTTAAATTTTTGTTAAATCAGCTCATTTTTTAACCAATAGGCCGAAATCGGCAAAATCCCTTATAAATCAAAAGAATAGACCGAGATAGGGTTGAGTGTTGTTCCAGTTTGGAACAAGAGTCCACTATTAAAGAACGTGGACTCCAACGTCAAAGGGCGAAAAACCGTCTATCAGGGCGATGGCCCACTACGTGAACCATCACCCTAATCAAGTTTTTTGGGGTCGAGGTGCCGTAAAGCACTAAATCGGAACCCTAAAGGGAGCCCCCGATTTAGAGCTTGACGGGGAAAGCCGGCGAACGTGGCGAGAAAGGAAGGGAAGAAAGCGAAAGGAGCGGGCGCTAGGGCGCTGGCAGGTGTAGCGGTCACGCTGCGCGTAACCACCACACCCGCCGCGCTTAATGCGCCGCTACAGGGCGCGTCCATTCGCCATTCAGGCTGCGCAACTGTTGGGAAGGGCGATCGGTGCGGGCCTCTTCGCTATTACGCCAGCTGGCGAAAGGGGGATGTGCTGCAAGGCGATTAAGTTGGGTAACGCCAGGGTTTTCCCAGTCACGACGTTGTAAAACGACGGCCAGTGAGCGCGCGTAATACGACTCACTATAGGGCGAATTGGGTACCGGCCGCAAATTAAAGCCTTCGAGCGTCCCAAAACCTTCTCAAGCAAGGTTTTCAGTATAATGTTACATGCGTACACGCGTCTGTACAGAAAAAAAAGAAAAATTTGAAATATAAATAACGTTCTTAATACTAACATAACTATAAAAAAATAAATAGGGACCTAGACCTTCAGGTTGTCTAACTCCTTCCTTTTCGGTTAGAGCGGAGTGGGGGGAGGGCGTGTATGTAAGCGTGACATAACTAATTACATGACCTATTAAGATCTGACGTCAGCGCTCCGCGGTTAGCTACTTACCATGGGGCCGAGGCGGCCTTAATTAAAGGCCTGGCCGTAATGGCCCTGCAGGAATTCGATATCAAGCTTATCGATACCGTCGACAAAGCTGATCTGTGCATACCACCTCTTAGCCTTAGCACAAGATGTAAGGTGGACTCCTTCTGAATGTTGTAATCAGACAGCGTTCTACCGTCTTCTAGCTGCTTACCGGCAAAGATCAATCTTTGTTGATCTGGAGGGATCCCCCCCGACATGCGGCCGCACCCACCGTACTCGTCAATTCCAAGGGCATCGGTAAACATCTGCTCAAACTCGAAGTCGGCCATATCCAGAGCGCCGTAGGGGGCGGAGTCGTGGGGGGTAAATCCCGGACCCGGGGAATCCCCGTCCCCCAACATGTCCAGATCGAAATCGTCTAGCGCGTCGGCATGCGCCATCGCCACGTCCTCGCCGTCTAAGTGGAGCTCGTCCCCCAGGCTGACATCGGTCGGGGGGGCCCAGATCCCCGGGAATTCCAGCCAGTCGCCGTTGCGAATAACCCCAACCGCCAGCCCTTCAATGGTGAAGCTCTGCTGACGAAGATCTACGACAATTGGTTTAAACTCGCTATTTTCTGGCAACAGTTCGACTTTATTGCCCTGTTTTTT
    // Caution:
    1.  This product is FOR RESEARCH USE ONLY!
    2.  The item is lyophilized form, Please take the powder plasmid by centrifugation at 5000rpm/min for 1min. Add 20μl ddH2O in to the tube of plasmid.