Skip to Content

pEYFP-N1, 2ug

https://www.gentaur.be/web/image/product.template/1480/image_1920?unique=325b45d
(0 review)

Terms and Conditions
30-day money-back guarantee
Shipping: 2-3 Business Days of Stock Products

pEYFP-N1 Information

Promoter: CMV

Replicon: pUC ori, F1 ori

Terminator: SV40 poly (A) signal

Plasmid classification: mammalian cells, fluorescent protein reporter vectors

Plasmid size: 4733bp

Prokaryotic resistance: Kan

Selection marker: Neo

Clonal strain: DH5 alpha

Culture conditions: 37

Expression host: lactation cells

Induction mode: no need to induce, transient expression.

5'sequencing primers: pEGFP-C-5:CATGGTCCTGCTGGAGTTCGTG

Primers for 3'sequencing: primers designed based on sequences

 

pEYFP-N1 Description

encodes an enhanced yellow-green variant of the Aequorea victoria green fluorescent protein (GFP). The EYFP gene contains four amino acid substitutions previously published as GFP-10C (1). The fluorescence excitation maximum of EYFP is 513 nm, and the emission spectrum has a peak at 527 nm (in the yellow-green region). When excited at 513 nm, the Em of EYFP is 36,500 cm–1M–1 and the fluorescence quantum yield is 0.63 (1), resulting in a bright fluorescent signal. The fluorescence level observed from EYFP is roughly equivalent to that from EGFP.

 

pEYFP-N1 Multiple cloning site

pEYFP-N1 Sequence

LOCUS       Exported File           4733 bp ds-DNA    circular SYN 25-1-2015

DEFINITION  .

ACCESSION   .

VERSION     .

KEYWORDS    Untitled

SOURCE      synthetic DNA construct

  ORGANISM  synthetic DNA construct

REFERENCE   1  (bases 1 to 4733)

  AUTHORS   .

  TITLE     Direct Submission

  JOURNAL   Exported 2015-1-25 from SnapGene 2.0.1