PMD2.G - 2 ug
(0 review)

444.72 444.72 USD 444.72

436.00 €

Not Available For Sale

    This combination does not exist.

    Terms and Conditions
    30-day money-back guarantee
    Shipping: 2-3 Business Days of Stock Products


    PVT2321      2ug


    pMD2.G Information

    Promoter: CMV

    Replicon: pUC ori

    Terminator: beta-globin poly (A)

    Plasmid classification: virus series, lentiviral packaging carrier

    Plasmid size: 5822bp

    Plasmid label: VSV-G

    Prokaryotic resistance: Amp

    Cloned strain: Stbl3

    Culture conditions: 37 centigrade, aerobic LB

    Expression host: mammalian cells

    Induction mode: no induction, instantaneous expression

    5'sequencing primers: CMV-F:CGCAAATGGGCGGTAGGCGTG

    3'sequencing primers: primers designed according to sequence



    pMD2.G Description

    PMD2. belong to the VSV-G expression plasmid, and can be used together with pSPAX2.


    pMD2.G Sequence

    LOCUS       Exported                5822 bp ds-DNA     circular SYN 24-OCT-2016

    DEFINITION  synthetic circular DNA


    VERSION     .

    KEYWORDS    Untitled 3

    SOURCE      synthetic DNA construct

      ORGANISM  synthetic DNA construct

    REFERENCE   1  (bases 1 to 5822)

      AUTHORS   .

      TITLE     Direct Submission

      JOURNAL   Exported Monday, October 24, 2016 from SnapGene Viewer 3.2.1


    FEATURES             Location/Qualifiers

         source          1..5822

                         /organism="synthetic DNA construct"

                         /mol_type="other DNA"

         polyA_site      1048..1442

                         /note="beta-globin poly(A)"

                         /note="human beta-globin polyadenylation signal"

         rep_origin      complement(1952..2540)



                         /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of 


         CDS             complement(2711..3571)





                         /note="confers resistance to ampicillin, carbenicillin, and

                         related antibiotics"







         promoter        complement(3572..3676)


                         /note="AmpR promoter"

         enhancer        3867..4246

                         /note="CMV enhancer"

                         /note="human cytomegalovirus immediate early enhancer"

         promoter        4247..4450

                         /note="CMV promoter"

                         /note="human cytomegalovirus (CMV) immediate early 


         intron          4584..5059

                         /note="beta-globin intron"

                         /note="internally truncated intron from human beta-globin"

         CDS             5134..847


                         /product="vesicular stomatitis virus G glycoprotein"


                         /note="Indiana strain"











            1 tggaggcaag gcctgcaaaa tgcaatactg caagcattgg ggagtcagac tcccatcagg

           61 tgtctggttc gagatggctg ataaggatct ctttgctgca gccagattcc ctgaatgccc

          121 agaagggtca agtatctctg ctccatctca gacctcagtg gatgtaagtc taattcagga

          181 cgttgagagg atcttggatt attccctctg ccaagaaacc tggagcaaaa tcagagcggg

          241 tcttccaatc tctccagtgg atctcagcta tcttgctcct aaaaacccag gaaccggtcc

          301 tgctttcacc ataatcaatg gtaccctaaa atactttgag accagataca tcagagtcga

          361 tattgctgct ccaatcctct caagaatggt cggaatgatc agtggaacta ccacagaaag

          421 ggaactgtgg gatgactggg caccatatga agacgtggaa attggaccca atggagttct

          481 gaggaccagt tcaggatata agtttccttt atacatgatt ggacatggta tgttggactc

          541 cgatcttcat cttagctcaa aggctcaggt gttcgaacat cctcacattc aagacgctgc

          601 ttcgcaactt cctgatgatg agagtttatt ttttggtgat actgggctat ccaaaaatcc

          661 aatcgagctt gtagaaggtt ggttcagtag ttggaaaagc tctattgcct cttttttctt

          721 tatcataggg ttaatcattg gactattctt ggttctccga gttggtatcc atctttgcat

          781 taaattaaag cacaccaaga aaagacagat ttatacagac atagagatga accgacttgg

          841 aaagtaactc aaatcctgca caacagattc ttcatgtttg gaccaaatca acttgtgata

          901 ccatgctcaa agaggcctca attatatttg agtttttaat ttttatgaaa aaaaaaaaaa

          961 aaaacggaat tcaccccacc agtgcaggct gcctatcaga aagtggtggc tggtgtggct

         1021 aatgccctgg cccacaagta tcactaagct cgctttcttg ctgtccaatt tctattaaag

         1081 gttcctttgt tccctaagtc caactactaa actgggggat attatgaagg gccttgagca

         1141 tctggattct gcctaataaa aaacatttat tttcattgca atgatgtatt taaattattt

         1201 ctgaatattt tactaaaaag ggaatgtggg aggtcagtgc atttaaaaca taaagaaatg

         1261 aagagctagt tcaaaccttg ggaaaataca ctatatctta aactccatga aagaaggtga

         1321 ggctgcaaac agctaatgca cattggcaac agcccctgat gcctatgcct tattcatccc

         1381 tcagaaaagg attcaagtag aggcttgatt tggaggttaa agttttgcta tgctgtattt

         1441 tacattactt attgttttag ctgtcctcat gaatgtcttt tcactaccca tttgcttatc

         1501 ctgcatctct cagccttgac tccactcagt tctcttgctt agagatacca cctttcccct

         1561 gaagtgttcc ttccatgttt tacggcgaga tggtttctcc tcgcctggcc actcagcctt

         1621 agttgtctct gttgtcttat agaggtctac ttgaagaagg aaaaacaggg ggcatggttt

         1681 gactgtcctg tgagcccttc ttccctgcct cccccactca cagtgacccg gaatccctcg

         1741 acatggcagt ctagcactag tgcggccgca gatctgcttc ctcgctcact gactcgctgc

         1801 gctcggtcgt tcggctgcgg cgagcggtat cagctcactc aaaggcggta atacggttat

         1861 ccacagaatc aggggataac gcaggaaaga acatgtgagc aaaaggccag caaaaggcca

         1921 ggaaccgtaa aaaggccgcg ttgctggcgt ttttccatag gctccgcccc cctgacgagc

         1981 atcacaaaaa tcgacgctca agtcagaggt ggcgaaaccc gacaggacta taaagatacc

         2041 aggcgtttcc ccctggaagc tccctcgtgc gctctcctgt tccgaccctg ccgcttaccg

         2101 gatacctgtc cgcctttctc ccttcgggaa gcgtggcgct ttctcatagc tcacgctgta

         2161 ggtatctcag ttcggtgtag gtcgttcgct ccaagctggg ctgtgtgcac gaaccccccg

         2221 ttcagcccga ccgctgcgcc ttatccggta actatcgtct tgagtccaac ccggtaagac

         2281 acgacttatc gccactggca gcagccactg gtaacaggat tagcagagcg aggtatgtag

         2341 gcggtgctac agagttcttg aagtggtggc ctaactacgg ctacactaga agaacagtat

         2401 ttggtatctg cgctctgctg aagccagtta ccttcggaaa aagagttggt agctcttgat

         2461 ccggcaaaca aaccaccgct ggtagcggtg gtttttttgt ttgcaagcag cagattacgc

         2521 gcagaaaaaa aggatctcaa gaagatcctt tgatcttttc tacggggtct gacgctcagt

         2581 ggaacgaaaa ctcacgttaa gggattttgg tcatgagatt atcaaaaagg atcttcacct

         2641 agatcctttt aaattaaaaa tgaagtttta aatcaatcta aagtatatat gagtaaactt

         2701 ggtctgacag ttaccaatgc ttaatcagtg aggcacctat ctcagcgatc tgtctatttc

         2761 gttcatccat agttgcctga ctccccgtcg tgtagataac tacgatacgg gagggcttac

         2821 catctggccc cagtgctgca atgataccgc gagacccacg ctcaccggct ccagatttat

         2881 cagcaataaa ccagccagcc ggaagggccg agcgcagaag tggtcctgca actttatccg

         2941 cctccatcca gtctattaat tgttgccggg aagctagagt aagtagttcg ccagttaata

         3001 gtttgcgcaa cgttgttgcc attgctacag gcatcgtggt gtcacgctcg tcgtttggta

         3061 tggcttcatt cagctccggt tcccaacgat caaggcgagt tacatgatcc cccatgttgt

         3121 gcaaaaaagc ggttagctcc ttcggtcctc cgatcgttgt cagaagtaag ttggccgcag

         3181 tgttatcact catggttatg gcagcactgc ataattctct tactgtcatg ccatccgtaa

         3241 gatgcttttc tgtgactggt gagtactcaa ccaagtcatt ctgagaatag tgtatgcggc

         3301 gaccgagttg ctcttgcccg gcgtcaatac gggataatac cgcgccacat agcagaactt

         3361 taaaagtgct catcattgga aaacgttctt cggggcgaaa actctcaagg atcttaccgc

         3421 tgttgagatc cagttcgatg taacccactc gtgcacccaa ctgatcttca gcatctttta

         3481 ctttcaccag cgtttctggg tgagcaaaaa caggaaggca aaatgccgca aaaaagggaa

         3541 taagggcgac acggaaatgt tgaatactca tactcttcct ttttcaatat tattgaagca

         3601 tttatcaggg ttattgtctc atgagcggat acatatttga atgtatttag aaaaataaac

         3661 aaataggggt tccgcgcaca tttccccgaa aagtgccacc tgacgtggat cccctgaggg

         3721 ggcccccatg ggctagagga tccggcctcg gcctctgcat aaataaaaaa aattagtcag

         3781 ccatgagctt ggcccattgc atacgttgta tccatatcat aatatgtaca tttatattgg

         3841 ctcatgtcca acattaccgc catgttgaca ttgattattg actagttatt aatagtaatc

         3901 aattacgggg tcattagttc atagcccata tatggagttc cgcgttacat aacttacggt

         3961 aaatggcccg cctggctgac cgcccaacga cccccgccca ttgacgtcaa taatgacgta

         4021 tgttcccata gtaacgccaa tagggacttt ccattgacgt caatgggtgg agtatttacg

         4081 gtaaactgcc cacttggcag tacatcaagt gtatcatatg ccaagtacgc cccctattga

         4141 cgtcaatgac ggtaaatggc ccgcctggca ttatgcccag tacatgacct tatgggactt

         4201 tcctacttgg cagtacatct acgtattagt catcgctatt accatggtga tgcggttttg

         4261 gcagtacatc aatgggcgtg gatagcggtt tgactcacgg ggatttccaa gtctccaccc

         4321 cattgacgtc aatgggagtt tgttttggca ccaaaatcaa cgggactttc caaaatgtcg

         4381 taacaactcc gccccattga cgcaaatggg cggtaggcgt gtacggtggg aggtctatat

         4441 aagcagagct cgtttagtga accgtcagat cgcctggaga cgccatccac gctgttttga

         4501 cctccataga agacaccggg accgatccag cctcccctcg aagcttacat gtggtaccga

         4561 gctcggatcc tgagaacttc agggtgagtc tatgggaccc ttgatgtttt ctttcccctt

         4621 cttttctatg gttaagttca tgtcatagga aggggagaag taacagggta cacatattga

         4681 ccaaatcagg gtaattttgc atttgtaatt ttaaaaaatg ctttcttctt ttaatatact

         4741 tttttgttta tcttatttct aatactttcc ctaatctctt tctttcaggg caataatgat

         4801 acaatgtatc atgcctcttt gcaccattct aaagaataac agtgataatt tctgggttaa

         4861 ggcaatagca atatttctgc atataaatat ttctgcatat aaattgtaac tgatgtaaga

         4921 ggtttcatat tgctaatagc agctacaatc cagctaccat tctgctttta ttttatggtt

         4981 gggataaggc tggattattc tgagtccaag ctaggccctt ttgctaatca tgttcatacc

         5041 tcttatcttc ctcccacagc tcctgggcaa cgtgctggtc tgtgtgctgg cccatcactt

         5101 tggcaaagca cgtgagatct gaattctgac actatgaagt gccttttgta cttagccttt

         5161 ttattcattg gggtgaattg caagttcacc atagtttttc cacacaacca aaaaggaaac

         5221 tggaaaaatg ttccttctaa ttaccattat tgcccgtcaa gctcagattt aaattggcat

         5281 aatgacttaa taggcacagc cttacaagtc aaaatgccca agagtcacaa ggctattcaa

         5341 gcagacggtt ggatgtgtca tgcttccaaa tgggtcacta cttgtgattt ccgctggtat

         5401 ggaccgaagt atataacaca ttccatccga tccttcactc catctgtaga acaatgcaag

         5461 gaaagcattg aacaaacgaa acaaggaact tggctgaatc caggcttccc tcctcaaagt

         5521 tgtggatatg caactgtgac ggatgccgaa gcagtgattg tccaggtgac tcctcaccat

         5581 gtgctggttg atgaatacac aggagaatgg gttgattcac agttcatcaa cggaaaatgc

         5641 agcaattaca tatgccccac tgtccataac tctacaacct ggcattctga ctataaggtc

         5701 aaagggctat gtgattctaa cctcatttcc atggacatca ccttcttctc agaggacgga

         5761 gagctatcat ccctgggaaa ggagggcaca gggttcagaa gtaactactt tgcttatgaa

         5821 ac


    1.  This product is FOR RESEARCH USE ONLY!
    2.  The item is lyophilized form, Please take the powder plasmid by centrifugation at 5000rpm/min for 1min. Add 20μl ddH2O in to the tube of plasmid.